Housekeeping Gene Selection Advisory: Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) and β-Actin Are Targets of miR-644a | PLOS ONE
Table S1. Sequence of primers used in real-time PCR Forward Primer Reverse Primer Human IL1β AGCTACGAATCTCCGACCAC CGTTATCCCATG
![PGB340Mi01 | Primer Pair for Beta Actin (ACTB) | Homo sapiens (Human), Mus musculus (Mouse), Rattus norvegicus (Rat) USCN(Wuhan USCN Business Co., Ltd. ) PGB340Mi01 | Primer Pair for Beta Actin (ACTB) | Homo sapiens (Human), Mus musculus (Mouse), Rattus norvegicus (Rat) USCN(Wuhan USCN Business Co., Ltd. )](http://static.cloud-clone.cn/static/product/big/CG.jpg)
PGB340Mi01 | Primer Pair for Beta Actin (ACTB) | Homo sapiens (Human), Mus musculus (Mouse), Rattus norvegicus (Rat) USCN(Wuhan USCN Business Co., Ltd. )
![Frontiers | β-Actin: Not a Suitable Internal Control of Hepatic Fibrosis Caused by Schistosoma japonicum Frontiers | β-Actin: Not a Suitable Internal Control of Hepatic Fibrosis Caused by Schistosoma japonicum](https://www.frontiersin.org/files/Articles/417850/fmicb-10-00066-HTML/image_m/fmicb-10-00066-t001.jpg)
Frontiers | β-Actin: Not a Suitable Internal Control of Hepatic Fibrosis Caused by Schistosoma japonicum
![Frontiers | β-Actin: Not a Suitable Internal Control of Hepatic Fibrosis Caused by Schistosoma japonicum Frontiers | β-Actin: Not a Suitable Internal Control of Hepatic Fibrosis Caused by Schistosoma japonicum](https://www.frontiersin.org/files/MyHome%20Article%20Library/417850/417850_Thumb_400.jpg)
Frontiers | β-Actin: Not a Suitable Internal Control of Hepatic Fibrosis Caused by Schistosoma japonicum
![Gene primers for rtPCR. β-actin was used as the housekeeping gene for... | Download Scientific Diagram Gene primers for rtPCR. β-actin was used as the housekeeping gene for... | Download Scientific Diagram](https://www.researchgate.net/publication/268155126/figure/fig1/AS:601668836147209@1520460437335/Gene-primers-for-rtPCR-b-actin-was-used-as-the-housekeeping-gene-for-sample.png)
Gene primers for rtPCR. β-actin was used as the housekeeping gene for... | Download Scientific Diagram
![Selective measurement of α smooth muscle actin: why β-actin can not be used as a housekeeping gene when tissue fibrosis occurs | BMC Molecular Biology | Full Text Selective measurement of α smooth muscle actin: why β-actin can not be used as a housekeeping gene when tissue fibrosis occurs | BMC Molecular Biology | Full Text](https://media.springernature.com/lw685/springer-static/image/art%3A10.1186%2Fs12867-017-0089-9/MediaObjects/12867_2017_89_Fig6_HTML.gif)
Selective measurement of α smooth muscle actin: why β-actin can not be used as a housekeeping gene when tissue fibrosis occurs | BMC Molecular Biology | Full Text
![β-actin dependent chromatin remodeling mediates compartment level changes in 3D genome architecture | Nature Communications β-actin dependent chromatin remodeling mediates compartment level changes in 3D genome architecture | Nature Communications](https://media.springernature.com/lw685/springer-static/image/art%3A10.1038%2Fs41467-021-25596-2/MediaObjects/41467_2021_25596_Fig1_HTML.png)
β-actin dependent chromatin remodeling mediates compartment level changes in 3D genome architecture | Nature Communications
![β-Actin and GAPDH housekeeping gene expression in asthmatic airways is variable and not suitable for normalising mRNA levels | Thorax β-Actin and GAPDH housekeeping gene expression in asthmatic airways is variable and not suitable for normalising mRNA levels | Thorax](https://thorax.bmj.com/content/thoraxjnl/57/9/765/F3.large.jpg?width=800&height=600&carousel=1)
β-Actin and GAPDH housekeeping gene expression in asthmatic airways is variable and not suitable for normalising mRNA levels | Thorax
Table S1 Sequences of primers used for quantitative RT-PCR analysis Primer Sequences (5' to 3') Mouse IFN-β Forward AGGGCGG
![β-Actin and GAPDH housekeeping gene expression in asthmatic airways is variable and not suitable for normalising mRNA levels | Thorax β-Actin and GAPDH housekeeping gene expression in asthmatic airways is variable and not suitable for normalising mRNA levels | Thorax](https://thorax.bmj.com/content/thoraxjnl/57/9/765/F4.large.jpg)
β-Actin and GAPDH housekeeping gene expression in asthmatic airways is variable and not suitable for normalising mRNA levels | Thorax
![Selective measurement of α smooth muscle actin: why β-actin can not be used as a housekeeping gene when tissue fibrosis occurs | BMC Molecular Biology | Full Text Selective measurement of α smooth muscle actin: why β-actin can not be used as a housekeeping gene when tissue fibrosis occurs | BMC Molecular Biology | Full Text](https://media.springernature.com/lw685/springer-static/image/art%3A10.1186%2Fs12867-017-0089-9/MediaObjects/12867_2017_89_Fig3_HTML.gif)
Selective measurement of α smooth muscle actin: why β-actin can not be used as a housekeeping gene when tissue fibrosis occurs | BMC Molecular Biology | Full Text
![Time for rethinking the different β‐actin transgenic mouse models? - Vanslembrouck - 2020 - Cytoskeleton - Wiley Online Library Time for rethinking the different β‐actin transgenic mouse models? - Vanslembrouck - 2020 - Cytoskeleton - Wiley Online Library](https://onlinelibrary.wiley.com/cms/asset/a4eb184b-caa3-4584-afc9-542b89009a4b/cm21647-fig-0002-m.jpg)