Sequence or primers used for qPCR analysis Name β-actin gene Forward... | Download Table
View Image
Housekeeping Gene Selection Advisory: Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) and β-Actin Are Targets of miR-644a | PLOS ONE
Table S1. Sequence of primers used in real-time PCR Forward Primer Reverse Primer Human IL1β AGCTACGAATCTCCGACCAC CGTTATCCCATG
Primers of AQP8 and β-actin for qPCR. | Download Table
PGB340Mi01 | Primer Pair for Beta Actin (ACTB) | Homo sapiens (Human), Mus musculus (Mouse), Rattus norvegicus (Rat) USCN(Wuhan USCN Business Co., Ltd. )
Product Manual Human beta actin RT-PCRmer™
Primers of real-time PCR the chicken β−actin and CAPN2 gene. | Download Table
Frontiers | β-Actin: Not a Suitable Internal Control of Hepatic Fibrosis Caused by Schistosoma japonicum
beta Actin (ACTB) Human qPCR Primer Pair (NM_001101) – HP204660 | OriGene
Frontiers | β-Actin: Not a Suitable Internal Control of Hepatic Fibrosis Caused by Schistosoma japonicum
RT-PCR primers for sirtuin genes (1-7) and β-actin. | Download Scientific Diagram
Gene primers for rtPCR. β-actin was used as the housekeeping gene for... | Download Scientific Diagram
Selective measurement of α smooth muscle actin: why β-actin can not be used as a housekeeping gene when tissue fibrosis occurs | BMC Molecular Biology | Full Text
β-actin dependent chromatin remodeling mediates compartment level changes in 3D genome architecture | Nature Communications
Primer sequences of C4A, C4B, CTins and Beta-actin qPCR runs. | Download Table
β-Actin and GAPDH housekeeping gene expression in asthmatic airways is variable and not suitable for normalising mRNA levels | Thorax
Table S1 Sequences of primers used for quantitative RT-PCR analysis Primer Sequences (5' to 3') Mouse IFN-β Forward AGGGCGG
Human beta-Actin qPCR Primer Pair | Sino Biological
Primer Sequences for Hb and β-Actin cDNA and Resulting Fragment Lengths. | Download Table
β-Actin and GAPDH housekeeping gene expression in asthmatic airways is variable and not suitable for normalising mRNA levels | Thorax
Human ACTB (Beta Actin) Endogenous Control (FAM™/MGB probe, non-primer limited)
Selective measurement of α smooth muscle actin: why β-actin can not be used as a housekeeping gene when tissue fibrosis occurs | BMC Molecular Biology | Full Text
Time for rethinking the different β‐actin transgenic mouse models? - Vanslembrouck - 2020 - Cytoskeleton - Wiley Online Library
Beta-actin Loading Control | OriGene
![THE™ beta Actin Antibody [HRP], mAb, Mouse - GenScript](https://www.genscript.com/product/documents/down?doc_name=3643_20071212210137.JPG&file=filecenter/document/3643_20071212210137.JPG "THE™ beta Actin Antibody [HRP], mAb, Mouse - GenScript")